View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6745_low_47 (Length: 240)
Name: NF6745_low_47
Description: NF6745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6745_low_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 24 - 223
Target Start/End: Original strand, 33219364 - 33219568
Alignment:
| Q |
24 |
cttcaataagaaaacaaatagtacaacttaacaatatttttgtcctaatattctaaatcatcaatatggaaaagcgaccctagctaatctagagtaaata |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33219364 |
cttcaataagaaaacaaatagtacaacttaacactatttttgtcctaatattctaaatcatcaatatggaaaagcgaccctagctaatctagagtaaata |
33219463 |
T |
|
| Q |
124 |
aagta-----tgtggttgtttttagttaggcatcgaacttacttgaatgtttcaactttagtattctttagttgaaatttaattatcacttatgtaacta |
218 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
33219464 |
aagtatggcttgtggttgtttttagttaggcatcgaacttacatgaatgtttcaactttagtattctttagttaaaatttatttatcacttatgtaacta |
33219563 |
T |
|
| Q |
219 |
tgttt |
223 |
Q |
| |
|
||||| |
|
|
| T |
33219564 |
tgttt |
33219568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University