View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6745_low_53 (Length: 234)
Name: NF6745_low_53
Description: NF6745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6745_low_53 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 28 - 219
Target Start/End: Complemental strand, 30274699 - 30274508
Alignment:
| Q |
28 |
attgtcacggtaggccatttatatgacatatgctaaatcaattacaacacatgtagcatcgacgttttatattgaaggcgtgagtgtcagacaacaacag |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30274699 |
attgtcacggtaggccatttatatgacatatgctaaatcaattacaacacatgtagcatcgacgctttatattgaaggcgtgagtgtcagacaacaacag |
30274600 |
T |
|
| Q |
128 |
tatagatacaacgctaacacatgtgataatatgcagtcatttttatgttatcactgatatttacgtgtcagtgtcattgtcgtatctgatgt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30274599 |
tatagatacaacgctaacacatgtgataatatgcagtcatttttatgttatcattgatatttacgtgtcagtgtcattgtcgtatctaatgt |
30274508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University