View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6745_low_56 (Length: 209)

Name: NF6745_low_56
Description: NF6745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6745_low_56
NF6745_low_56
[»] chr4 (1 HSPs)
chr4 (62-187)||(35272444-35272568)


Alignment Details
Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 62 - 187
Target Start/End: Original strand, 35272444 - 35272568
Alignment:
62 gcaaggggcatcaatgaagaaaccattcttgggaaacatgattaaagnnnnnnnnnnnnnnnncagacatgaataattttagaactgacattactaccga 161  Q
    |||||||||||||||||||||||||||||||||||||||||||||||                ||||||||||| |||||||||||||||||||||||||    
35272444 gcaaggggcatcaatgaagaaaccattcttgggaaacatgattaaagaaaaaactaaaaaaa-cagacatgaatgattttagaactgacattactaccga 35272542  T
162 aattgcacatcaagaactgattaatg 187  Q
    ||||||||||||||||||||||||||    
35272543 aattgcacatcaagaactgattaatg 35272568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University