View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6747_low_11 (Length: 226)
Name: NF6747_low_11
Description: NF6747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6747_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 11 - 207
Target Start/End: Complemental strand, 37113634 - 37113438
Alignment:
| Q |
11 |
tgagatgaagaagacactgaattggtgggacttgatgtggttcggtatgggcgccgtcattggttctggaatatttgtgcttaccggacttgaggctagg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37113634 |
tgagatgaagaagacactgaattggtgggacttgatgtggttcggtatgggcgccgtcattggttctggaatatttgtgcttaccggacttgaggctagg |
37113535 |
T |
 |
| Q |
111 |
caggaagcaggtccggcagttgtattgtcgtttgtcatctccggtatatctgctttgctatcggtgttttgttatacagaatttgctgtggaaattc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37113534 |
caggaagcaggtccggcagttgtattgtcgtttgtcatctccggtatatctgctttgctatcggtgttttgttatacagaatttgctgtggaaattc |
37113438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 11 - 207
Target Start/End: Complemental strand, 37126372 - 37126176
Alignment:
| Q |
11 |
tgagatgaagaagacactgaattggtgggacttgatgtggttcggtatgggcgccgtcattggttctggaatatttgtgcttaccggacttgaggctagg |
110 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||| ||||| || || ||| | || || |||||||||||||| |||||||||||||||| | |
|
|
| T |
37126372 |
tgagatgaagaagacgctgaactggtgggacttgatgtggtttggtatcggtgcggtcgtcggctccggaatatttgtgctgaccggacttgaggctaag |
37126273 |
T |
 |
| Q |
111 |
caggaagcaggtccggcagttgtattgtcgtttgtcatctccggtatatctgctttgctatcggtgttttgttatacagaatttgctgtggaaattc |
207 |
Q |
| |
|
||| | ||||||||||||||||| ||||| |||||||||||||| |||||||||||| |||| || ||||| |||||||| ||||| |||||||||| |
|
|
| T |
37126272 |
cagcatgcaggtccggcagttgtgttgtcatttgtcatctccggcatatctgctttgttatcagtattttgctatacagagtttgcggtggaaattc |
37126176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University