View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6747_low_6 (Length: 312)
Name: NF6747_low_6
Description: NF6747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6747_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 17 - 304
Target Start/End: Original strand, 6815782 - 6816069
Alignment:
| Q |
17 |
atcatatggaataaagtggtgtcttttaaagtgtctcttttagtatgaagattgttgaattaaagactttcaactaaatataatttaattcatcatggag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6815782 |
atcatatggaataaagtggtgtcttttaaagtgtctcttttaatatgaagattgttgaattaaagactttcaactaaatataatttaattcatcatggag |
6815881 |
T |
|
| Q |
117 |
ttcttcaaccaagatcgttgttatgctcgggtgattgtgggatggtagaatgtggtgaatcatgtcttcttggatttcgannnnnnngggaagtagtttg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6815882 |
ttcttcaaccaagatcgttgttatgctcgggtgattgtgggatggtagaatatggtgaatcatgtcttcttggatttcgatttttttgggaagtagtttg |
6815981 |
T |
|
| Q |
217 |
gtccttcgttttaaagtggttaggtatatctagcgtgcttttatctgatattggtttgcaatctactcagttggatgatgtccatctc |
304 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||| |||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
6815982 |
gtccttcgttttgaagtggttagggatatctagcgtgctttcatctgatattggtttgcaatcttctcagttggatggtgtccatctc |
6816069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University