View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6750_high_6 (Length: 265)
Name: NF6750_high_6
Description: NF6750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6750_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 9 - 260
Target Start/End: Complemental strand, 50654524 - 50654274
Alignment:
| Q |
9 |
gacatcataacaaggaaggtttagcagggaaagagttaaacaaggagggattgggtgagggaagacttatgtgctactcttaattttttaatatatctga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50654524 |
gacatcataacaaggaaggtttagcagggaaagagttaaacaaggagggattgggtgagggaagacttatgtgctactcttaattttttaatatatctga |
50654425 |
T |
 |
| Q |
109 |
accctttaattattttaatagatccaatagtacactggtgaggaacttgatggctctctcaccttagaagccaccaagtttataacctatgttattccat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50654424 |
accctttaattattttaatagatccaatggtacactggtgaggaacttgatggctctctcacctt-tctgccaccaagtttataacctatgttattccat |
50654326 |
T |
 |
| Q |
209 |
tctctcatcctatacnnnnnnngactggggtagaagggtgatgatgtccatc |
260 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
50654325 |
tctctcatcctatactttttttgactggggtagaagggtgatgatgttcatc |
50654274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University