View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6750_low_12 (Length: 234)
Name: NF6750_low_12
Description: NF6750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6750_low_12 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 16 - 234
Target Start/End: Complemental strand, 17759425 - 17759199
Alignment:
| Q |
16 |
tatattaacgtagaagttagtatttagaacttctaaaaatcaaagcaaaaatgcatcgtaaaacgtgc--------ttttgtgtgttgcaaacgagaaac |
107 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||| |||||||| ||||||||||||||| |||||||| |||||||||| |||| |
|
|
| T |
17759425 |
tatattaacgtagaagttagtattcagaacttctgaaaatcacagcaaaaacacatcgtaaaacgtgcaaacatgtttttgtgtattgcaaacgataaac |
17759326 |
T |
|
| Q |
108 |
caaatacatacgaagttggaagtctctcttgataaacatagttgatagaactacggtatgtaaatgttagagtttgaacttttaattcttcacttattta |
207 |
Q |
| |
|
|||| || | |||| | |||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
17759325 |
caaacacgcataaagtggaaagtctctctcgataagcatagttgatagaactatagtatgtaaatgttagagtttgaacttttaattcttcacattttta |
17759226 |
T |
|
| Q |
208 |
cttgatttgatagtgggtggtttccta |
234 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
17759225 |
cttgatttgatagtgggtggtttccta |
17759199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 79 - 115
Target Start/End: Original strand, 8311155 - 8311191
Alignment:
| Q |
79 |
cgtgcttttgtgtgttgcaaacgagaaaccaaataca |
115 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8311155 |
cgtgtttttgtgtgttgcaaacgagaaaccaaataca |
8311191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 72
Target Start/End: Complemental strand, 6807166 - 6807117
Alignment:
| Q |
23 |
acgtagaagttagtatttagaacttctaaaaatcaaagcaaaaatgcatc |
72 |
Q |
| |
|
||||||||| ||||||||||| ||||| |||||| |||||||||||||| |
|
|
| T |
6807166 |
acgtagaagctagtatttagagcttctggaaatcacagcaaaaatgcatc |
6807117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University