View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6750_low_9 (Length: 244)
Name: NF6750_low_9
Description: NF6750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6750_low_9 |
 | |
|
| [»] scaffold0028 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0028 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 11 - 242
Target Start/End: Original strand, 124557 - 124788
Alignment:
| Q |
11 |
acatcacaaattcgtattaaatacaaaatgcattaaacaaaagcttaattaaaagaatgatgatttaacctataaggacatcgggccttagtacgccctt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
124557 |
acatcacaaattcgtattaaatacaaaatgcattaaacaaaagcttaattaaaagaatgatgatttaacctataaggacatcgggccttagtacgccctt |
124656 |
T |
|
| Q |
111 |
ctttatcatatcaaattccttgaagcagaatggtggtttgggtatgtcatgtttgtcgatgctatcaatagttgttgcagcattaaacaccagcctaaac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
124657 |
ctttatcatatcaaattccttgaagcagaatggtggtttgggtatgtcatgtttatcgatgctatcgatagttgttgcaacattaaacaccagcctaaac |
124756 |
T |
|
| Q |
211 |
ttatgattagttgctttgatgtccatctcatt |
242 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |
|
|
| T |
124757 |
ttatgattagttgctttgatggtcatctcatt |
124788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 73 - 167
Target Start/End: Original strand, 23699791 - 23699885
Alignment:
| Q |
73 |
atttaacctataaggacatcgggccttagtacgcccttctttatcatatcaaattccttgaagcagaatggtggtttgggtatgtcatgtttgtc |
167 |
Q |
| |
|
|||| ||||||||||||||| ||||||| || |||||||| ||| |||||| |||||||| | ||||| |||| | ||||||||||||||||| |
|
|
| T |
23699791 |
attttacctataaggacatctggccttactattcccttcttgatctcatcaaactccttgaaactgaatgatggtctaggtatgtcatgtttgtc |
23699885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 78 - 227
Target Start/End: Original strand, 22079490 - 22079639
Alignment:
| Q |
78 |
acctataaggacatcgggccttagtacgcccttctttatcatatcaaattccttgaagcagaatggtggtttgggtatgtcatgtttgtcgatgctatca |
177 |
Q |
| |
|
|||||| |||||||| ||||||||| | |||||||| ||| |||||| ||||| ||| ||| | ||||||||| |||||||| ||||| ||| | ||| |
|
|
| T |
22079490 |
acctattaggacatctggccttagtgctcccttcttgatctcatcaaagtccttaaagttgaaagatggtttgggaatgtcatgcttgtcaatgttgtca |
22079589 |
T |
|
| Q |
178 |
atagttgttgcagcattaaacaccagcctaaacttatgattagttgcttt |
227 |
Q |
| |
|
| | ||||| || |||||||||||| || ||| ||||| ||||||||| |
|
|
| T |
22079590 |
acacttgttccaccattaaacaccaaccaaaatggatgatcagttgcttt |
22079639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University