View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6753_low_13 (Length: 271)
Name: NF6753_low_13
Description: NF6753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6753_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 22 - 258
Target Start/End: Original strand, 48063115 - 48063351
Alignment:
| Q |
22 |
gactattggtctgcgaggccgagagtcgtgatggtagtactagtaatacaaaaataaaagcaacgattcatcccctggtgcaaagcacaggtgtctatgt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48063115 |
gactattggtctgcgaggccgagagtcgtgatggtagtactagtaatacaaaaataaaagcaacgattcatcccctggtgcaaagcacaggtatctatgt |
48063214 |
T |
|
| Q |
122 |
gaaaacaatataagcattagcttaccctctcaatgctgctatcttggtgtgacctccattgctctctggtgaatggttgtaaggagacactatgaaccca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48063215 |
gaaaacaatataagcattagcttaccctctcaatgctgctatcttggtgtgacctccattgctctctggtgaatggttgtaaggagacactatgaaccca |
48063314 |
T |
|
| Q |
222 |
taattccacaattggattctcgctctgcatgcaagtt |
258 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48063315 |
taattccacaattggattctcactctgcatgcaagtt |
48063351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 139 - 251
Target Start/End: Original strand, 48100243 - 48100355
Alignment:
| Q |
139 |
tagcttaccctctcaatgctgctatcttggtgtgacctccattgctctctggtgaatggttgtaaggagacactatgaacccataattccacaattggat |
238 |
Q |
| |
|
|||||||||||||||| ||| ||||| ||||| |||||||| | ||||||||||||||||||||||||||| | |||||| ||||||| |||||| |
|
|
| T |
48100243 |
tagcttaccctctcaacgctatcgtcttgctgtgatctccattgtttcttggtgaatggttgtaaggagacactatcagcccatagttccacagttggat |
48100342 |
T |
|
| Q |
239 |
tctcgctctgcat |
251 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
48100343 |
tctcgcactgcat |
48100355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 137 - 231
Target Start/End: Original strand, 48067193 - 48067287
Alignment:
| Q |
137 |
attagcttaccctctcaatgctgctatcttggtgtgacctccattgctctctggtgaatggttgtaaggagacactatgaacccataattccaca |
231 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||| | || ||||||||||||| |||||||||| | ||||||||||||| |
|
|
| T |
48067193 |
attagcttaccctctcaatgctgtcggcttggtgtgatctccattgtgttttgttgaatggttgtaaagagacactatcagtccataattccaca |
48067287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 135 - 231
Target Start/End: Original strand, 48106909 - 48107005
Alignment:
| Q |
135 |
gcattagcttaccctctcaatgctgctatcttggtgtgacctccattgctctctggtgaatggttgtaaggagacactatgaacccataattccaca |
231 |
Q |
| |
|
||||||||||||||| ||||| || | ||||||||||| ||||||| || | | || |||||||| ||||| ||||||| | |||||| ||||||| |
|
|
| T |
48106909 |
gcattagcttaccctttcaatattgttgtcttggtgtgatctccattcctttttagtaaatggttgcaaggacacactatcagcccatatttccaca |
48107005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University