View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6753_low_20 (Length: 217)
Name: NF6753_low_20
Description: NF6753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6753_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 50 - 198
Target Start/End: Original strand, 40783484 - 40783632
Alignment:
| Q |
50 |
tgatgtgttgaatgaatatagaataaaaatgatatacatatatcattgttgtttaatgattgagtatatattttgtaaacaataattgagtaatattgag |
149 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40783484 |
tgatgtgttgaataaatatagaataaaaatgatatacatatatcattgttgtttaatgattgagtatatatttcgtaaacaataattgagtaatattgag |
40783583 |
T |
 |
| Q |
150 |
aattataagcaaaaggagagtacttgacataaattattcattagagtat |
198 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40783584 |
aattataagcaaaaggagagtagttgacataaattattcattagagtat |
40783632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University