View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6753_low_9 (Length: 345)
Name: NF6753_low_9
Description: NF6753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6753_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 281; Significance: 1e-157; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 10 - 302
Target Start/End: Complemental strand, 43019941 - 43019649
Alignment:
| Q |
10 |
atggacatcccaattcgcatcatcaacaccaccgtcaacgacctatgcaagaagagccaccacgttcatgcaaactcgaatgcaaacgaccacgttcttc |
109 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43019941 |
atggccatcccaatttgcatcatcaacaccaccgtcaacgacctatgcaagaagagccaccacgttcatgcaaactcgaatgcaaacgaccacgttcttc |
43019842 |
T |
 |
| Q |
110 |
cgcaacatcaaacggttattacgaagtgagaaaaaatgaagacagcaatgacgatgatcgacatttcaaaaggagacggccgaggtatgagttggtggca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43019841 |
cgcaacatcaaacggttattacgaagtgagaaaaaatgaagacaacaatgacgatgatcgacatttcaaaaggagacggccgaggtatgagttggtggca |
43019742 |
T |
 |
| Q |
210 |
gcataggcgaagaacaacaactgtaccgttggaaggatttttagggaaatttgatttgatggcatatttcaattattttgccactgtaatttg |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43019741 |
gcataggcgaagaacaacaactgtaccgttggaaggatttttagggaaatttgatttgatggcatatttcaattattttgccactgtaatttg |
43019649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 112 - 302
Target Start/End: Complemental strand, 35058482 - 35058292
Alignment:
| Q |
112 |
caacatcaaacggttattacgaagtgagaaaaaatgaagacagcaatgacgatgatcgacatttcaaaaggagacggccgaggtatgagttggtggcagc |
211 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
35058482 |
caacatcaaactgttattacgaagtgagaaaaaacgaagacaga---gacgatgatcgacatttcaaaaggagacggccgaggtatgagttggtggaagc |
35058386 |
T |
 |
| Q |
212 |
ataggcgaaga---acaacaactgtaccgttggaaggatttttagggaaatttgatttgatggcatatttcaattattttgccactgtaatttg |
302 |
Q |
| |
|
||||| ||||| ||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35058385 |
ataggtgaagagcaacaacaactttaccgttggaaggatttttagggaaattttatttgatggcatatttcaattattttgccaatgtaatttg |
35058292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 258 - 302
Target Start/End: Complemental strand, 42807726 - 42807682
Alignment:
| Q |
258 |
atttgatttgatggcatatttcaattattttgccactgtaatttg |
302 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
42807726 |
atttgatttgatggcataattcaattattttgccaatgtaatttg |
42807682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 42807802 - 42807763
Alignment:
| Q |
162 |
gatgatcgacatttcaaaaggagacggccgaggtatgagt |
201 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42807802 |
gatgatcgacatttcaaaaggagacggtcgaggtatgagt |
42807763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 109 - 146
Target Start/End: Complemental strand, 42807876 - 42807839
Alignment:
| Q |
109 |
ccgcaacatcaaacggttattacgaagtgagaaaaaat |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42807876 |
ccgcaacatcaaacggttattacgaagtgagaagaaat |
42807839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 48 - 77
Target Start/End: Complemental strand, 35058528 - 35058499
Alignment:
| Q |
48 |
cgacctatgcaagaagagccaccacgttca |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35058528 |
cgacctatgcaagaagagccaccacgttca |
35058499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University