View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6754_high_3 (Length: 478)
Name: NF6754_high_3
Description: NF6754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6754_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 371; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 371; E-Value: 0
Query Start/End: Original strand, 92 - 474
Target Start/End: Complemental strand, 46932033 - 46931651
Alignment:
| Q |
92 |
tgatcaagatttaagaactaatttacatacaagttggagaattaccaccaccaagagattaaggatgatcatgatcttctttttcttgatttgggattat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46932033 |
tgatcaagatttaagaactaatttacatacaagttggataattaccaccaccaagagattaaggatgatcatgatcttctttttcttgatttgggattat |
46931934 |
T |
 |
| Q |
192 |
ttgatttatgtgttgaagaagcagcaactggtttaccaaacaaaccacaaaaaccacatgttgcaaccttaggagaaggtgggtcaattgatgttggtgc |
291 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46931933 |
ttgatttatgtgctgaagaagcagcaactggtttaccaaacaaaccacaaaaaccacatgttgcaaccttaggagaaggtgggtcaattgatgttggtgc |
46931834 |
T |
 |
| Q |
292 |
aacgttgaccgatcgatatggtcttgctccagctgatctgcttctctccaacgtgccagttgatgcactctcttgttctagttgattctgattcaaacca |
391 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46931833 |
aacgttgaccgatcgatatggtcttgctccagctgatctgcttctctccaacgtaccagttgatgcactctcttgttctagttgattctgattcaaacca |
46931734 |
T |
 |
| Q |
392 |
gacaagaatttatcatcccaaaccaatcctgatgaaccttgtctcctgaatgatgctaatgatttctgcagctcagccatctc |
474 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46931733 |
gacaagaatttatcatcccaaaccaatcctgatgaaccttgtctcctgaatgatgctaatgatttctgcagctcagccatctc |
46931651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 402 - 445
Target Start/End: Complemental strand, 44510360 - 44510317
Alignment:
| Q |
402 |
tatcatcccaaaccaatcctgatgaaccttgtctcctgaatgat |
445 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| ||||||||| |
|
|
| T |
44510360 |
tatcatcccaaacaaaccctgatgaaccttgtcttctgaatgat |
44510317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University