View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6754_high_6 (Length: 353)
Name: NF6754_high_6
Description: NF6754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6754_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 6e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 6 - 125
Target Start/End: Original strand, 8137910 - 8138029
Alignment:
| Q |
6 |
tgttacagtcatagttgcaattataaaagtggctatattgcacttcttgatgctgtggccatgttcctgtcgtagagacataatatcttgatgttactgc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8137910 |
tgttacagtcatagttgcaattataaaagtggctgtattgcacttcttgatgctgtggccatgttcctgtcgtagagacataatatcttgatgttactgc |
8138009 |
T |
 |
| Q |
106 |
cctatattgcaatctttgat |
125 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
8138010 |
cctatattgcaatctttgat |
8138029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 145 - 189
Target Start/End: Original strand, 8138041 - 8138085
Alignment:
| Q |
145 |
aaaaaagataaaaggaatatattaaaaaatgattagaaccattca |
189 |
Q |
| |
|
||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8138041 |
aaagaagataaaaggaatatattaaaaaatgataagaaccattca |
8138085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University