View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6755_high_2 (Length: 418)
Name: NF6755_high_2
Description: NF6755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6755_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 4e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 4e-85
Query Start/End: Original strand, 18 - 232
Target Start/End: Original strand, 1612459 - 1612673
Alignment:
| Q |
18 |
gaatcaagtagaaagtggcttgtatattaagttcaaacatcttttatggaatgttggttctgcttataaactgttatgcaatctgtttatacaatttcgc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1612459 |
gaatcaagtagaaagtggcttgtatattaagttcaaacatcttttatggaatgttggttctgcttataaactgttatgcaatctgtttatacaatttcgc |
1612558 |
T |
|
| Q |
118 |
ttctttaggtttcaatctagaaaaccacgcaatttaataatgggttcatcttaacatg-tgatccaaatgcaaatgcctaattctttgcttaaaacaaca |
216 |
Q |
| |
|
||||| |||||||||||||||| ||| |||||||| |||||| ||||| |||||||| ||| || ||||||||||||||||||||||| ||||| |||| |
|
|
| T |
1612559 |
ttcttaaggtttcaatctagaaggccaggcaatttagtaatggtttcattttaacatgatgaacc-aatgcaaatgcctaattctttgcctaaaataaca |
1612657 |
T |
|
| Q |
217 |
gaagttatgctgatat |
232 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
1612658 |
gaagttatgctgatat |
1612673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 255 - 407
Target Start/End: Complemental strand, 20627357 - 20627204
Alignment:
| Q |
255 |
ctgttcttttttagcagtttatgatactatgnnnnnnnctctttctatgaagttcacatgaaaa-ttaaactacttatgagtcataaagaagatcaagca |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||| || | |||||||||||| ||| |||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
20627357 |
ctgttcttttttagcagtttatgatactatgtttttt-ctttgtctatgaagttcgcattaaaaattaaactacttatgagtcataaagatgatcaagct |
20627259 |
T |
|
| Q |
354 |
tactttacggcttgattaaaatcagttata-ttttttcccttgctctcaaatttt |
407 |
Q |
| |
|
||||||||||||||||| |||||||| || |||||| ||||||||||||||||| |
|
|
| T |
20627258 |
tactttacggcttgattggaatcagttctattttttttccttgctctcaaatttt |
20627204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University