View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6758_high_22 (Length: 237)
Name: NF6758_high_22
Description: NF6758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6758_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 37408944 - 37408712
Alignment:
| Q |
1 |
cattgcactcagtctaggagaatctagagccggttcacctggcctcacaggaaaaatcgacatcgccatcggaaaactctcgtctctcgtagatttaacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37408944 |
cattgcactcagtctaggagaatctagagccggttcacctggcctcacaggaaaaatcgacaccgccatcggaaaactctcgtctctcgtagatttaacc |
37408845 |
T |
 |
| Q |
101 |
gtttctccggggagaatttacggtcatctccctcagtccatttcacagttgaagaatctcaggtttctcggtattagtcggaatttcatctccggtgaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37408844 |
gtttctccggggagaatttacggtcatctccctcagtccatttcacagttgaagaatctcaggtttctcggtattagtcggaatttcatctccggtgaga |
37408745 |
T |
 |
| Q |
201 |
ttccggcagggcttggtcaacttcgtgatgtcc |
233 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
37408744 |
ttccggcagggcttggtcaacttcgtaatgtcc |
37408712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 106 - 207
Target Start/End: Complemental strand, 40085295 - 40085194
Alignment:
| Q |
106 |
tccggggagaatttacggtcatctccctcagtccatttcacagttgaagaatctcaggtttctcggtattagtcggaatttcatctccggtgagattccg |
205 |
Q |
| |
|
|||||| ||||| || |||| ||| ||||| |||||||| |||||||||||||||||||| ||| ||| | || ||||||||||||||||||||| |
|
|
| T |
40085295 |
tccgggaagaatatatggtcctcttcctcaaaccatttcaagcttgaagaatctcaggtttcttggtgttaacagaaacttcatctccggtgagattccg |
40085196 |
T |
 |
| Q |
206 |
gc |
207 |
Q |
| |
|
|| |
|
|
| T |
40085195 |
gc |
40085194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University