View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6758_low_19 (Length: 250)
Name: NF6758_low_19
Description: NF6758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6758_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-125; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 5 - 238
Target Start/End: Original strand, 49976293 - 49976526
Alignment:
| Q |
5 |
gagatgaactgtcccttattgtttgattaactcaataaatattgtgtgtgcgtgtgtatgatgaagaagggaggtaagtgagagagagtgtagcagaaga |
104 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49976293 |
gagaagaactgtcccttactgtttgattaactcaataaatattgtgtgtgcgtgtgtatgatgaagaagggaggtaagtgagagagagtgtagcagaaga |
49976392 |
T |
 |
| Q |
105 |
actgatagagaactttcaaagctctttatcttctacaatcactcaaactatagcctctacaatatctttttctttctgtagtctctttctgctggtatca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49976393 |
actgatagagaactttcaaagctctttatcttctacaatcactcaaactatagcctctacaatatctttttctttctgtagtctctttctgctggtatca |
49976492 |
T |
 |
| Q |
205 |
tattacaatcaccatgtaggtcttccgtccccca |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
49976493 |
tattacaatcaccatgtaggtcttccgtccccca |
49976526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 84 - 150
Target Start/End: Complemental strand, 49954478 - 49954413
Alignment:
| Q |
84 |
gagagagagtgtagcagaagaactgatagagaactttcaaagctctttatcttctacaatcactcaa |
150 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49954478 |
gagagagag-gtggcagaagaactgatagagaactttcaaagctctttatcttctaccatcactcaa |
49954413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University