View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6758_low_28 (Length: 227)
Name: NF6758_low_28
Description: NF6758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6758_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 34587834 - 34588053
Alignment:
| Q |
1 |
caaacattgatgtctaattgcctcagcattatcacattcttgcttctctttctttaacaagacaataaagtcactgcctattannnnnnn-gttaagcaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34587834 |
caaacattgatgtctaattgcctcagcattatcacattcttgcttcactttctttaacaagacaataaagtcactgcctattattttttttgttaagcaa |
34587933 |
T |
 |
| Q |
100 |
acaagtgtaacaaatctaaaagtaaggaaaatgatttgcaacaataatttaccattatatgtgatagtgatacatacggttgtgcaaataatacttatgc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34587934 |
acaagtgtaacaaatctaaaagtaaggaaaatgatttgcaacaataatttaccat-atatgtgatagtgatacatacggttgtgcaaataatacttatgc |
34588032 |
T |
 |
| Q |
200 |
atggacccaaacattgatgtc |
220 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
34588033 |
atggacccaaacattgatgtc |
34588053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University