View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6758_low_8 (Length: 380)
Name: NF6758_low_8
Description: NF6758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6758_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 3e-73; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 220 - 375
Target Start/End: Original strand, 51419967 - 51420122
Alignment:
| Q |
220 |
cccacataattggagtgagtcctatcatcacgctaaatactaccaattccagtcaaatagacaattgcaaaactggaatggtagttcataaaatagcata |
319 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
51419967 |
cccacataattggagtgagacctatcatcacgccaaatactaccaattccagtcaaatagacaattgcaaaactggaatggaagttcataaaatagcata |
51420066 |
T |
|
| Q |
320 |
tccattattggctggaaaactacaaagttagcatgaatgatgtggcatattattgg |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51420067 |
tccattattggctggaaaactacaaagttagcatgaatgatgtggcatattcttgg |
51420122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 51419758 - 51419822
Alignment:
| Q |
1 |
gttttgttatctattttagtcatatctttttctgattcgatagattaatctctttagttatacat |
65 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51419758 |
gttttgttatctattttaatcatatctttttctgattcgatagattaatgtctttagttatacat |
51419822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 120 - 154
Target Start/End: Original strand, 51419866 - 51419900
Alignment:
| Q |
120 |
cctcacacaatatcaaatgtaaagctttatttttt |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
51419866 |
cctcacacaatatcaaatgtaaagctttatttttt |
51419900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University