View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6762_high_12 (Length: 213)

Name: NF6762_high_12
Description: NF6762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6762_high_12
NF6762_high_12
[»] chr2 (1 HSPs)
chr2 (15-195)||(8469538-8469718)


Alignment Details
Target: chr2 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 15 - 195
Target Start/End: Complemental strand, 8469718 - 8469538
Alignment:
15 tggtgttcaattgttcaacttgttcatggagtatgcacctaagggaactctttcagatgcagttcgcaatggaaatggaatggaagaagctatggtggga 114  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8469718 tggtgttcaattgttcaacttgttcatggagtatgcacccaagggaactctttcagatgcagttcgcaatggaaatggaatggaagaagctatggtggga 8469619  T
115 ttctatgcgcgtcaaattctgctagggcttaactatcttcatttgaatgggatagtgcattgtgatttgaagggacagaac 195  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8469618 ttctatgcgcgtcaaattctgctagggcttaactatcttcatttgaatgggatagtgcattgtgatttgaagggacagaac 8469538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University