View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6762_high_9 (Length: 282)
Name: NF6762_high_9
Description: NF6762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6762_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 19 - 271
Target Start/End: Complemental strand, 29680710 - 29680458
Alignment:
| Q |
19 |
acctagccaccgtctgtctccttaataaggtgttaactattgaaattgctgcagctatatagtgttttaataatgtgaactttactcctgtcaaaaattt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29680710 |
acctagccaccgtctgtctccttaataaggtgttaactattgaaattgctgcagctatatagtgttttaataatgtgaactttactcctgtcaaaaattt |
29680611 |
T |
|
| Q |
119 |
aataatgtgaaccttactttattttttaggggatgtaaaccttacttggagggccttttatttatttatttagggtatttggcctaatatagattccctt |
218 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29680610 |
aataatgtgaaccttacttttttttttaggggatgtaaaccttacttggagggccttttatttatttatttagggtatttggcctaatatagattccctt |
29680511 |
T |
|
| Q |
219 |
gtcttgaactaccttggaagcaggggccctaatatgataaaatagcaaatatt |
271 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29680510 |
gtcttgaactacgttggaagcaggggccctaatatgataaaatagcaaatatt |
29680458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University