View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6762_low_10 (Length: 283)
Name: NF6762_low_10
Description: NF6762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6762_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 12 - 266
Target Start/End: Complemental strand, 37558362 - 37558108
Alignment:
| Q |
12 |
attcgatcaatcgagagaagagagaagatgtgggtgttctacatgatatctcttcccctcacaatgggaatggttctgttaacgcttcggtacttcgctg |
111 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37558362 |
attcgatcaatcgagagaagagcgaagatgtgggtgttctacatgatatctcttcccctcacaatgggaatggttctgttaacgcttcggtacttcgctg |
37558263 |
T |
 |
| Q |
112 |
gaccttccgtaccactctacgttctcttcaccgttggatacacttggttcgtttccctctccatcatcatcctcgtccccgctgatatctgggtggtact |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37558262 |
gaccttccgtaccactctacgttctcttcaccgttggatacacttggttcgtttccctctccatcatcatcctcgtccccgctgatatctgggtggtact |
37558163 |
T |
 |
| Q |
212 |
attcctttttctatctctcattcccttcaattcaacttaattcaccattttagta |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37558162 |
attcctttttctatctctcattcccttcaattcaacttaattcaccattttagta |
37558108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 129 - 210
Target Start/End: Complemental strand, 39370143 - 39370062
Alignment:
| Q |
129 |
tacgttctcttcaccgttggatacacttggttcgtttccctctccatcatcatcctcgtccccgctgatatctgggtggtac |
210 |
Q |
| |
|
||||| || |||||||||||||| ||||||||| ||| || ||||| ||||| |||||||| |||||||| |||| ||||| |
|
|
| T |
39370143 |
tacgtgcttttcaccgttggatatacttggttctgttctctttccattatcattctcgtccctgctgatatttgggcggtac |
39370062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University