View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6762_low_14 (Length: 213)
Name: NF6762_low_14
Description: NF6762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6762_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 15 - 195
Target Start/End: Complemental strand, 8469718 - 8469538
Alignment:
| Q |
15 |
tggtgttcaattgttcaacttgttcatggagtatgcacctaagggaactctttcagatgcagttcgcaatggaaatggaatggaagaagctatggtggga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8469718 |
tggtgttcaattgttcaacttgttcatggagtatgcacccaagggaactctttcagatgcagttcgcaatggaaatggaatggaagaagctatggtggga |
8469619 |
T |
 |
| Q |
115 |
ttctatgcgcgtcaaattctgctagggcttaactatcttcatttgaatgggatagtgcattgtgatttgaagggacagaac |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8469618 |
ttctatgcgcgtcaaattctgctagggcttaactatcttcatttgaatgggatagtgcattgtgatttgaagggacagaac |
8469538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University