View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6771_high_8 (Length: 308)
Name: NF6771_high_8
Description: NF6771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6771_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 11 - 288
Target Start/End: Original strand, 39073279 - 39073556
Alignment:
| Q |
11 |
atgatccacccaaaatccatagtagtttagtttagtttggtccaatttgaagaagctcgtttagacaaaaatggggtcaatgagatcaagggctgagatt |
110 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39073279 |
atgatccacccaaaatccagagtagtttagtttagtttggtccaatttgaagaagctcgtttagacaaaaatggggtcaatgagatcaagggctgagatt |
39073378 |
T |
 |
| Q |
111 |
agccattaagtaggtcccaccatgagaagtattaaagggaacacagcccacatgggtgaacatgcattctcatctgtgtctcaactctcaacccattcac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39073379 |
agccattaagtaggtcccaccatgagaagtattaaagggaacacagcccacatgggtgaacatgcattctcatctgtgtctcaactctcaacccattcac |
39073478 |
T |
 |
| Q |
211 |
ggatggtacggttttcccatgtgtaaattaaatttagtttctatttttgaagaaagaaaattaatatgtgtatcacct |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39073479 |
ggatggtacggttttcccatgtgtaaattaaatttagtttctatttttgaagaaagaaaattaatatgtgtatcacct |
39073556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University