View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6771_low_16 (Length: 253)
Name: NF6771_low_16
Description: NF6771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6771_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 50 - 236
Target Start/End: Complemental strand, 35679327 - 35679141
Alignment:
| Q |
50 |
tctttgtgtttagcaagtggagcaattatgttggatgtgtggctgggcatttttctttgctgtggtttttaattgcggtggttcatcattaagttcatgc |
149 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35679327 |
tctttgtgtttagcaagtggagcaataatgttggatgtgtggctgggcatttttctttggtgtggtttttaattgcggcggttcatcattaagttcatgc |
35679228 |
T |
 |
| Q |
150 |
aattttgattgtagaggtaccaaagctagtttccaggtgattgatatataatatgctgcatagcgatccaaaacttgcataattgtg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35679227 |
aattttgattgtagaggtaccaaagctagtttgcaggtgattgatatataatatgctgcatagcgatccaaaatttgcataattgtg |
35679141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University