View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6773_high_3 (Length: 237)

Name: NF6773_high_3
Description: NF6773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6773_high_3
NF6773_high_3
[»] chr1 (2 HSPs)
chr1 (18-231)||(52947998-52948213)
chr1 (139-234)||(31810722-31810817)
[»] chr6 (3 HSPs)
chr6 (131-234)||(7797472-7797575)
chr6 (131-215)||(19393467-19393551)
chr6 (139-234)||(30320396-30320491)
[»] chr2 (1 HSPs)
chr2 (139-234)||(22055067-22055162)
[»] chr4 (1 HSPs)
chr4 (149-234)||(28430206-28430291)


Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 18 - 231
Target Start/End: Original strand, 52947998 - 52948213
Alignment:
18 aagtttatgtttctaaaatttgacagggatgagtgtgtcagttgtatttcaccaagggggtgaatttgttagggactacattttgtattacactgggggt 117  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |||||| |||||||||||||||||||||    
52947998 aagtttatgtttctaaaatttgacagggatgagtgtgtcaattgtatttcaccatgggggtgaatttgttacggactatattttgtattacactgggggt 52948097  T
118 caagaacacgtagt--taatgggattgatagggataggtggtgttactttgaagctactggtatactaaaagagttaggttatgatgatcaccttaagta 215  Q
    ||||||||||||||  ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||    
52948098 caagaacacgtagtagtaatgggattgatagggataggtggtgttacttcgaagcgactggtatactaaaagagttaggttatgatgatcaccttaagta 52948197  T
216 tcgtttattgtggtat 231  Q
    || ||||| |||||||    
52948198 tcatttatggtggtat 52948213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 139 - 234
Target Start/End: Original strand, 31810722 - 31810817
Alignment:
139 attgatagggataggtggtgttactttgaagctactggtatactaaaagagttaggttatgatgatcaccttaagtatcgtttattgtggtatatt 234  Q
    ||||||| ||| | |||||| ||||||||||||||||| ||| | ||||| ||||| |||  |||||||||||||||| | |||| ||||||||||    
31810722 attgataaggacaagtggtgctactttgaagctactgggatattgaaagatttaggatattctgatcaccttaagtataggttatggtggtatatt 31810817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 44; Significance: 4e-16; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 131 - 234
Target Start/End: Original strand, 7797472 - 7797575
Alignment:
131 ttaatgggattgatagggataggtggtgttactttgaagctactggtatactaaaagagttaggttatgatgatcaccttaagtatcgtttattgtggta 230  Q
    |||||| |||||||| ||| | |||||| ||||||||||||||||| ||| | ||||| ||||| |||  |||||||||||||||| | |||| ||||||    
7797472 ttaatgagattgataaggacaagtggtgctactttgaagctactgggatattgaaagatttaggatattttgatcaccttaagtataggttatggtggta 7797571  T
231 tatt 234  Q
    ||||    
7797572 tatt 7797575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 131 - 215
Target Start/End: Original strand, 19393467 - 19393551
Alignment:
131 ttaatgggattgatagggataggtggtgttactttgaagctactggtatactaaaagagttaggttatgatgatcaccttaagta 215  Q
    |||||| |||||||| ||| | |||||| ||||||||||||||| | ||| | ||||| ||||| ||||||||||||||||||||    
19393467 ttaatgagattgataaggacaagtggtgctactttgaagctactaggatattgaaagatttaggatatgatgatcaccttaagta 19393551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 139 - 234
Target Start/End: Complemental strand, 30320491 - 30320396
Alignment:
139 attgatagggataggtggtgttactttgaagctactggtatactaaaagagttaggttatgatgatcaccttaagtatcgtttattgtggtatatt 234  Q
    ||||||| ||| | |||||| ||||||||||||||||| ||| | ||||| ||||| |||  |||||||||||||||| | |||| ||||||||||    
30320491 attgataaggacaagtggtgctactttgaagctactgggatattgaaagatttaggatattctgatcaccttaagtataggttatggtggtatatt 30320396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 139 - 234
Target Start/End: Original strand, 22055067 - 22055162
Alignment:
139 attgatagggataggtggtgttactttgaagctactggtatactaaaagagttaggttatgatgatcaccttaagtatcgtttattgtggtatatt 234  Q
    ||||||| ||| | ||| || ||||||||||||||||| ||| | ||||| ||||| |||  |||||||||||||||| | |||| ||||||||||    
22055067 attgataaggacaagtgttgctactttgaagctactgggatattgaaagatttaggatattctgatcaccttaagtataggttatggtggtatatt 22055162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 149 - 234
Target Start/End: Complemental strand, 28430291 - 28430206
Alignment:
149 ataggtggtgttactttgaagctactggtatactaaaagagttaggttatgatgatcaccttaagtatcgtttattgtggtatatt 234  Q
    |||||||| | || |||||||| ||||||||  ||||  |||| || ||||||||||| ||||||||||| |||| ||||||||||    
28430291 ataggtggagctattttgaagccactggtattttaaagcagtttggatatgatgatcatcttaagtatcgattatggtggtatatt 28430206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University