View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6774_high_10 (Length: 288)
Name: NF6774_high_10
Description: NF6774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6774_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 278
Target Start/End: Complemental strand, 39257042 - 39256766
Alignment:
| Q |
1 |
tacactcaaaactagggggtgtttgcgaatcagttcggatcgattttgcggcaaaaagtcatttgatccaaaaacatccaataagattcacnnnnnnn-c |
99 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39257042 |
tacactcaaaactagggg-tgtttgcgaatcagttcggatcgattttgcggcaaaaagtcatttgatccaaaaacatccaataagattcacttttttttc |
39256944 |
T |
|
| Q |
100 |
agtttgcagtatttttggaccacatttggatgtgaacacccttacccaaaaccttaaaacattgggtatatgggtccctcgcttatatgttgctcaacac |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39256943 |
agtttgcagtatttttggaccacatttggatgtgaacacccctacccaaaacattaaaacattgggtatatgggtccctcgcttatatgttgctcaacac |
39256844 |
T |
|
| Q |
200 |
cctcatttcatccaatgtaaaaaattcttactctcatttgacaccctaacaggagggaaggtctttcatgtgatgtcca |
278 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39256843 |
cctcatttcatccaatgta-aaaattcttactctcatttgacaccctaacaggagggaaggtctttcatgtgatgtcca |
39256766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 17 - 73
Target Start/End: Complemental strand, 5987735 - 5987679
Alignment:
| Q |
17 |
gggtgtttgcgaatcagttcggatcgattttgcggcaaaaagtcatttgatccaaaa |
73 |
Q |
| |
|
|||||||||||| ||||| ||||||||||| || |||| |||||||||||||||| |
|
|
| T |
5987735 |
gggtgtttgcgatacagtttggatcgattttaaggtaaaatgtcatttgatccaaaa |
5987679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 144 - 199
Target Start/End: Complemental strand, 27603821 - 27603765
Alignment:
| Q |
144 |
cccaaaaccttaaaacattgggtatatgggtccc-tcgcttatatgttgctcaacac |
199 |
Q |
| |
|
||||||||||||| ||||| | ||||||| |||| |||||| ||||||||||||||| |
|
|
| T |
27603821 |
cccaaaaccttaacacattagatatatggatcccctcgcttctatgttgctcaacac |
27603765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 143 - 175
Target Start/End: Original strand, 21396172 - 21396204
Alignment:
| Q |
143 |
acccaaaaccttaaaacattgggtatatgggtc |
175 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
21396172 |
acccaaaaccttaagacattgggtatatgggtc |
21396204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University