View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6774_low_12 (Length: 367)
Name: NF6774_low_12
Description: NF6774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6774_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 10 - 348
Target Start/End: Original strand, 360954 - 361292
Alignment:
| Q |
10 |
atgaatgccgcgagcaacgagattccttttaaagtattgaagttaggaatttgtgaaaggagtaactgtatacaaacaaagaagcaaatataatatgttt |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
360954 |
atgaatgccgcgagcagcgagattccttttaaagtattgaagttaggaatttgtgaaaggagtaactgtatacaaacaaagaagcagatataatatgttt |
361053 |
T |
 |
| Q |
110 |
gtctaatttcatcaaacattggcattattggagtcattatttcacagaacttcttaagtgattttccaccagtgactgaatacacaatggttgaagcaac |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
361054 |
gtctaatttcatcaaacattggcattattggagtcattatttcacagaacttcttaagtgattttccaccagtgactgaatacacaatggttgaagcaac |
361153 |
T |
 |
| Q |
210 |
ctgaacaatcaattgttgtatcattataacccagaatccaactttgccttgaaatacatgttctcctaaatcaaagtatctatcaaatctcttccctgga |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
361154 |
ctgaacaatcaattgttgtatcattataacccagaatccaactttgccttgaaatacatgttctcctaaatcaaagtatctatcaaatctcttccctgga |
361253 |
T |
 |
| Q |
310 |
accaattcgtgcatttgcactagttgccatagtgagtaa |
348 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
361254 |
accaattcatgcatttgcactagttgccacagtgagtaa |
361292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University