View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6774_low_37 (Length: 220)
Name: NF6774_low_37
Description: NF6774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6774_low_37 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 220
Target Start/End: Original strand, 53661905 - 53662106
Alignment:
| Q |
19 |
tgtcagctatcagtaattcaacatatacttacccacaaacatatcaaagagatgaaatgatactactcacaaatcactgaacggtccagatgcaattttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53661905 |
tgtcagctatcagtaattcaacatatacttacccacaaacatatcaaagagatgaaatgatactactcacaaatcactgaacggtccagatgcaattttc |
53662004 |
T |
|
| Q |
119 |
ttttcaaatctcaaccaacttgcttcacttgttgagacgccattttcacgggtgggaaaaattacatgtctagatataaagttcatcctaattttctctt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53662005 |
ttttcaaatctcaaccaacttgcttcacttgttgagacgccgttttcacgggtgggaaaaattacatgtctagatataaagttcatcctaattttctctt |
53662104 |
T |
|
| Q |
219 |
gc |
220 |
Q |
| |
|
|| |
|
|
| T |
53662105 |
gc |
53662106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University