View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6776_high_14 (Length: 405)
Name: NF6776_high_14
Description: NF6776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6776_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 46 - 360
Target Start/End: Original strand, 25187803 - 25188117
Alignment:
| Q |
46 |
gacaagatagagtgaataatctctttgaaggcaagagattatcatatttttcacatcttattacttgctttccttttcttccatctagtcaactaaaata |
145 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||||||||| |||||||||||| | | ||||||||||||||||| |||| ||||||| |
|
|
| T |
25187803 |
gacaagatagagtgaataatatctttgagggcaagagattatcatattttcaacatcttattacctcatctccttttcttccatctaatcaattaaaata |
25187902 |
T |
 |
| Q |
146 |
tatccgcttgtattgagtttacaacgggaccgcaccgataggtatccgcccaaaaaatttcaaactttaaccgatgaaactcattttacttgtgcgagtt |
245 |
Q |
| |
|
|||| |||| |||||| |||||||||| |||||| | ||||| ||||| |||||| | |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25187903 |
tatctgcttatattgaatttacaacggaaccgcatcaataggaatccgtccaaaactgtccaaactttaaccgaggaaactcattttacttgtgcgagtt |
25188002 |
T |
 |
| Q |
246 |
caagtttcacattgctactaaaaacaattattttttatgatatacatgataatctaacattcaatcaacttgtttggatcgttctaacggtgttaaaaat |
345 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| ||||||| |||| |||||||| |
|
|
| T |
25188003 |
aaagtttcgcattgctactaaaaacaattattttttatgatctacatgataatttaacattcaatcaacttgtttggaccgttctagcggtattaaaaat |
25188102 |
T |
 |
| Q |
346 |
gtgatcgtttcaagt |
360 |
Q |
| |
|
|||||| |||||||| |
|
|
| T |
25188103 |
gtgatcctttcaagt |
25188117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 18 - 46
Target Start/End: Original strand, 2362065 - 2362093
Alignment:
| Q |
18 |
tgttcgtgtccgtatccgtacttcatagg |
46 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2362065 |
tgttcgtgtccgtatccgtacttcatagg |
2362093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University