View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6776_high_34 (Length: 229)
Name: NF6776_high_34
Description: NF6776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6776_high_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 14 - 204
Target Start/End: Complemental strand, 40356925 - 40356736
Alignment:
| Q |
14 |
tggtgttgaccttcctattgatttttaatgcagttataatttacaactaggaattgttaacaaagaaggtatgaagtaaattaacatgaaaaggagattc |
113 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40356925 |
tggtgtcgaccttcctattgatttttaatgcagttataatttacaactaggaat-gttaacaaagaatgtatgaagtaaattaacatgaaaaggagatta |
40356827 |
T |
|
| Q |
114 |
tgagttgtcatgatttttcttttattccctttctttattcatctgtcaatacttttattttcagtggtttcatatatgttctcctattgtg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
40356826 |
tgagttgtcatgatttttcttttattccctttctttattcatctgtgaatacttttattttcatttgtttcatatatgttctcctattgtg |
40356736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University