View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6776_high_35 (Length: 228)
Name: NF6776_high_35
Description: NF6776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6776_high_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 19 - 161
Target Start/End: Complemental strand, 44859063 - 44858921
Alignment:
| Q |
19 |
agttccaaattctcaagtggtttttctagaatcgacactatcaccgtgacaacatcaccgttagtcactgcagatttcaagtcccacagatactccaact |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44859063 |
agttccaaattctcaagtggtttttctagaatcgacactatcaccgtgacaacatcaccgttagtcactgcagatttcaagtcccacagatactccaact |
44858964 |
T |
 |
| Q |
119 |
gctgagatacctcagtcgaaccaggttcaatcggcattgtaag |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44858963 |
gctgagatacctcagtcgaaccaggttcaatcggcattgtaag |
44858921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University