View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6776_high_41 (Length: 206)
Name: NF6776_high_41
Description: NF6776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6776_high_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 6 - 187
Target Start/End: Complemental strand, 35965742 - 35965560
Alignment:
| Q |
6 |
gatggacatcaaa-gtgtggtgagaacgaagctataatttataatcgttgaaatctcattggtcagcaggaaggagatgacccaccaccctccaagttag |
104 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35965742 |
gatggacatcaaacgtgtggtgagaacgaagctataatttataatcgttgaaatctcattggtcagcaggaaggagatgacccaccaccctccaagttag |
35965643 |
T |
 |
| Q |
105 |
gtgttaataatcaattctaaatacaaaatcaattatactaataaaaagtgaaaccaaacatacatttactattccagctggac |
187 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35965642 |
gtgtttataatcaattctaaatacaaaatcaattatactaacaaaaagtgaaaccaaacatacatttactattccagctggac |
35965560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University