View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6776_low_18 (Length: 395)
Name: NF6776_low_18
Description: NF6776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6776_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 157 - 390
Target Start/End: Complemental strand, 40854190 - 40853956
Alignment:
| Q |
157 |
aagagaaaagcaaataacaaaagctagacgtagtattatgttgcattatccagtaatcaaagtatggaagaaagcctggatggtagtgtttgtgaagatg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40854190 |
aagagaaaagcaaataacaaaagctagacgtagtatcatgttgcattatccagtaatcaaagtatggaagaaagcctggatggtagtgtttgtgaagatg |
40854091 |
T |
|
| Q |
257 |
acaaggctatgatatttgcaaacaatgaaacccagctggaagaagtttgcgattgctggtacttggaggatcacagatacaggtaattg-tttgcttctt |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40854090 |
acaaggctatgatatttgcaaacaatgaaacccagctggaagaagtttgcgattgctggtacttggaggatcacagatacaggtaattgttttgcttctt |
40853991 |
T |
|
| Q |
356 |
caatattcaccattttattatagatcacctttcct |
390 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
40853990 |
caatattcaccattttattatagatcacctttcct |
40853956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 18 - 146
Target Start/End: Complemental strand, 40854453 - 40854325
Alignment:
| Q |
18 |
ttatgtgtttgattttccgtagttgtttttggggcatattggcaagaaaattatatcttggtggtggtacctgttagggttggaaaaatattggacaagg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40854453 |
ttatgtgtttgattttccgtagttgtttttggggcatattggcaagaaaattatatcttggtggtggtacctgttagggttggaaaaatattggacaagg |
40854354 |
T |
|
| Q |
118 |
tcaagttctttgtaacacgaatttgaagt |
146 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40854353 |
tcaagttctttgtaacacgaatttgaagt |
40854325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 349 - 390
Target Start/End: Complemental strand, 40858402 - 40858361
Alignment:
| Q |
349 |
gcttcttcaatattcaccattttattatagatcacctttcct |
390 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||| |||| |
|
|
| T |
40858402 |
gcttctacaatattcaccatgttattatagatcacctgtcct |
40858361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University