View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6776_low_28 (Length: 303)
Name: NF6776_low_28
Description: NF6776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6776_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 285
Target Start/End: Original strand, 5950204 - 5950488
Alignment:
| Q |
1 |
aatttagagaaaagggtaggagctcaactagatcaggcttcacttgtggatcttctcattccaaatatgggatactcggtcgagacgctttatgatatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5950204 |
aatttagagaaaagggtaggagctcaactagatcaggcttcacttgtggatcttctcattccaaatatgggatactcggtcgagacgctttatgatatag |
5950303 |
T |
|
| Q |
101 |
attgtattcagaggattctggaccattttatgtctatctaccagcctgcatctttatctgcttctccatgtataactgaaattggaacattaattgctgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5950304 |
attgtattcagaggattctggaccattttatgtctatctaccagcctgcatctttatctgcttctccatgtataactgaaattggaacattaattgctgg |
5950403 |
T |
|
| Q |
201 |
ggttgatacgttgacaccgatgacaatggtcgctaacttggtagatggatatcttgccgaagtcgcttcagatgctaatctaaac |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5950404 |
ggttgatacgttgacaccgatgacaatggtcgctaacttggtagatggatatcttgccgaagtcgcttcagatgctaatctaaac |
5950488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 42 - 134
Target Start/End: Complemental strand, 28320734 - 28320642
Alignment:
| Q |
42 |
acttgtggatcttctcattccaaatatgggatactcggtcgagacgctttatgatatagattgtattcagaggattctggaccattttatgtc |
134 |
Q |
| |
|
|||||||||| || | || |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||| | || ||||||||||| |
|
|
| T |
28320734 |
acttgtggatattttgataccaaatatgggatattcagttgagacactttatgatatagattgtattcaaagaattattgatcattttatgtc |
28320642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University