View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6776_low_36 (Length: 254)
Name: NF6776_low_36
Description: NF6776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6776_low_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 14 - 250
Target Start/End: Complemental strand, 46294739 - 46294503
Alignment:
| Q |
14 |
atcacctgcaccaacacgagcaaaaatgcaatcacgaacagatatgctcgctttgtcacatggaacaaagcaaccaacttgagccatcaaaatattcact |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46294739 |
atcacctgcaccaacacgagcaaaaatgcaatcacgaacagatatgctcgctttgtcacatggaacaaagcaaccaacttgagccatcaaaatattcact |
46294640 |
T |
|
| Q |
114 |
cccacctacacaaaaaccattatgcaaatcaaatctctaagcccaaatagcaaggatgcaagtatctgaattgtatgtgtgaactaaaatatctatacaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46294639 |
cccacctacacaaaaaccattatgcaaatcaaatctctaagcccaaatagcaaggatgcaagtatctgaattgtatgtgtgaactaaaatatctatacaa |
46294540 |
T |
|
| Q |
214 |
agaaaggtgagacactccaatttgatgtccatctcat |
250 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
46294539 |
agaaaggtgagacactccaatttgatggccatgtcat |
46294503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University