View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6776_low_37 (Length: 247)
Name: NF6776_low_37
Description: NF6776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6776_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 21 - 238
Target Start/End: Complemental strand, 10557256 - 10557039
Alignment:
| Q |
21 |
ctagttgctggatcaaaacctggtagagctccttcattgtaccttctctttgcttcttttctacactctagtgcatactttatatggtttctgaactcac |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10557256 |
ctagttgctggatcaaaacctggtagagctccttcattgtaccttctctttgcttcttttctacactctagtgcatactttatatggtttctgaactcac |
10557157 |
T |
 |
| Q |
121 |
gttgcaaatcagcaacaaatttcaaagcatctttggttagaatttttgcaaactctgcatcatatcttcccctaacttcgacaccttctggtgcgtcgta |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
10557156 |
gttgcaaatcagcaacaaatttcaaagcatctttggttagaatttttgcaaactctgcatcatatcttcccctaacttcgacgccttctggtgcatcgta |
10557057 |
T |
 |
| Q |
221 |
gttagagatgatattctt |
238 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
10557056 |
gttagagatgatattctt |
10557039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University