View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6776_low_53 (Length: 205)
Name: NF6776_low_53
Description: NF6776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6776_low_53 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 14725763 - 14725576
Alignment:
| Q |
18 |
gttttgaggattgaaatgaagaatgtgagtgtggcttttgggtttctttcttggaaatgaaaagccaaagccaaagccaaa------tgctatgctaccg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14725763 |
gttttgaggattgaaatgaagaatgtgagtgtggcttttgggtttctttcttggaaatcaaaagccaaagccaaagccaaagccaaatgctatgctaccg |
14725664 |
T |
|
| Q |
112 |
tatgagctaagttttgcagggagggtaattattctctgtgactcgttcttaccgtgggtgggtg---tcatgatgcatgattttgatg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14725663 |
tatgagctaagttttgcagggagggtaattattctctgtgactcgttcttaccgtgggtgggtgtcatcatgatgcatgattttgatg |
14725576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University