View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6778_low_7 (Length: 309)
Name: NF6778_low_7
Description: NF6778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6778_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 200 - 297
Target Start/End: Complemental strand, 30431897 - 30431801
Alignment:
| Q |
200 |
agaggctggtgtgggagaactgatggagggaaacattatttcaagggagtggaaacttaacttcgcatagaaaactttttgtttgggaagaacactta |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
30431897 |
agaggctggtgtgggagaactgatggagggaaacattatttcaagggagtgg-aacttaacttggcatagacaactttttgtttgggaagaacactta |
30431801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 15 - 105
Target Start/End: Complemental strand, 30431990 - 30431900
Alignment:
| Q |
15 |
atcaaggtggtggaaaaatattgttaatttagatatgtttggtgggcaaggttggtttaatccggaggttgtgagaagggtagggaacagt |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
30431990 |
atcaaggtagtggaaaaatattgttaattttgatatgtttggtgggcaaggttggtttaatccgtaggttttgagaagggtagggaacagt |
30431900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University