View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6779_high_6 (Length: 239)
Name: NF6779_high_6
Description: NF6779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6779_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 109 - 222
Target Start/End: Complemental strand, 48198981 - 48198868
Alignment:
| Q |
109 |
ggattcttctcaagattctaggttggctggtttggtgaaaaatgcttctattaagagagatgaatctagtttcgatcgtgttcctgtttatgttaaagag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
48198981 |
ggattcttctcaagattctaggttggctggtttggtgaaaaatgcttctattaagagagatgaatctagtttcgatcgtgttcctgtttatgttaaggag |
48198882 |
T |
|
| Q |
209 |
ttaattgctggtgg |
222 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
48198881 |
ttaattgctggtgg |
48198868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 48199083 - 48199017
Alignment:
| Q |
1 |
ccgttctctttctctagaagtagatgggataacgagttttctgagcttcaaagtggatagattggtt |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48199083 |
ccgttctctttctctagaagtagatgggataacgagttttctgagcttcaaagtggatagattggtt |
48199017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University