View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6781_high_16 (Length: 323)
Name: NF6781_high_16
Description: NF6781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6781_high_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 16 - 286
Target Start/End: Original strand, 3600243 - 3600513
Alignment:
| Q |
16 |
cattttgaacgtggggagaagatttttgcagcctgatgagtgttgttagtttccttcttgctgagactcatctacattttgaaagctaaaattttaaaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3600243 |
cattttgaacgtggggagaagatttttgcagcctgatgagtgttgttagtttccttcttgctgagactcatctacattttgaaagctaaaattttaaaat |
3600342 |
T |
|
| Q |
116 |
tgtatacatattgggagtcaaggatgacagatgtgatataaaatgtgaaatgatgacatatattatgtgatcacttgcctcctttattttgtttgttcat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| ||||||||| |
|
|
| T |
3600343 |
tgtatacatattgggagtcaaggatgacagatgtgatataaaatgtgaaatgatgacatatattatgtgatcactttcctcctttgttttatttgttcat |
3600442 |
T |
|
| Q |
216 |
ttaacatggctagtagtatgagaaactgattcactcaatcatttggatggtctttctttctttccttcgtt |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3600443 |
ttaacatggctagtagtatgagaaactgattcactcaatcatttggttggtctttctttctttccttcgtt |
3600513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University