View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6781_high_19 (Length: 254)
Name: NF6781_high_19
Description: NF6781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6781_high_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 8 - 250
Target Start/End: Original strand, 5217267 - 5217509
Alignment:
| Q |
8 |
tggacatcaaagacgtttttcattagaaatgtcagtgttatgacataatatattatgggtttttctatcatnnnnnnnnnnnnngttgctaaagaagtta |
107 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5217267 |
tggacaccaaagacgtttttcaacagaaatgttagtgttatgacgtaatatattatgggtttttctatcataaaaaaaaaaaaagttgctaaagaagtta |
5217366 |
T |
|
| Q |
108 |
gtaaccataagttactagtaaccaaagcattttgacttttcttatgaaaaagagtaacatttatttaattataatgagaattgtattgaatgttgccgac |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
5217367 |
gtaaccataagttactagtaaccaaagcattttgacttttcttatgaaaaagagtaacatttatttaattataatgagaatggtcttgaatgttgccgac |
5217466 |
T |
|
| Q |
208 |
aatatatacaggttgatagtgcaaacaagtatgggatattatt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5217467 |
aatatatacaggttgatagtgcaaacaagtatgggatattatt |
5217509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University