View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6781_low_10 (Length: 388)
Name: NF6781_low_10
Description: NF6781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6781_low_10 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 361; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 361; E-Value: 0
Query Start/End: Original strand, 20 - 388
Target Start/End: Original strand, 8153801 - 8154169
Alignment:
| Q |
20 |
tctacaacgttggtggctttgattttggtggcaactttaatgtgggatttgtctcggaagattagtaagtgtgtttttgtcgaccaacatcctcgtactt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8153801 |
tctacaacgttggtggctttgattttggtggcaactttaatgtgggatttgtctcggaagattagtaagtgtgtttttgtcgaccaacatcctcgtactt |
8153900 |
T |
|
| Q |
120 |
cccaacacaataccatgtcttattgtaaaggtggaatctgttggcacggcgtggcggatcgctcgccggcatcacaacttcacttcaaacttcctcttca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8153901 |
cccaacacaataccatgtcttattgtaaaggtggaatctgttggcacggcgtggcggatcgctcgccggcatcacaacttcacttcaaacttcctcttca |
8154000 |
T |
|
| Q |
220 |
ccttcctcatatctagaaacatctacttcatgtgttgagttcaagtgtgagtattagtccgtgaatgaactaaatatttgatatacgagagatgttttgg |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8154001 |
ccttcctcatatctagaaacatctacttcatgtgttgagttcaagtgtgagtattagtccatgaatgaactaaatatttgatatacgagagatgttttgg |
8154100 |
T |
|
| Q |
320 |
atagatatatgatcgacgtctctgtctcttgtggtcatgttttagtttgttgttgctctctacgctctc |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8154101 |
atagatatatgatcgacgtctctgtctcttgtggtcatgttttagtttgttgttgctctccacgctctc |
8154169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University