View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6781_low_24 (Length: 242)
Name: NF6781_low_24
Description: NF6781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6781_low_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 20 - 225
Target Start/End: Complemental strand, 28612881 - 28612676
Alignment:
| Q |
20 |
gtatgttacaagcaaatgtgacagaggacattaacattgatatcaaaagtacgatttggttttgaattttaatgtaaagaaatgtcaacactatcaatgt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28612881 |
gtatgttacaagcaaatgtgacagaggacattaacattgatatcaaaagtacgatttggttttgaattttaatgtaaagaaatgtcaacactatcaatgt |
28612782 |
T |
 |
| Q |
120 |
ttatcaattggtgcactggcaccatgaatgagctagctagctagtagttctgaaatgtattattttcctgctcccataacctttgtaccatgtctttggt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28612781 |
ttatcaattggtgcactggcaccatgaatgagctagctagctagtagttctgaaatgtattattttcctgctcccataacctttgtaccatgtctttggt |
28612682 |
T |
 |
| Q |
220 |
tccttc |
225 |
Q |
| |
|
|||||| |
|
|
| T |
28612681 |
tccttc |
28612676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University