View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6781_low_28 (Length: 222)
Name: NF6781_low_28
Description: NF6781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6781_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 25779802 - 25780018
Alignment:
| Q |
1 |
gagctcagcaacacgttgtttacggagtttatcaagccatggaacgtgatcggaatcttcagccgtggcggcggagacatcaccgttctgttgtggcggc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
25779802 |
gagctcagcaacacgttgtttacggagtttatcaagccatggaacgtgatcggaatcttcagccgtgacggcggagacatcgccgttctgttgtggcggc |
25779901 |
T |
 |
| Q |
101 |
gggacgtcgtctttgaatcggaggtttagatcgtgaaatttttgttcgcagtggtgtgcggtggcgaggagggaagtgtggtcggtacgtgactgaacct |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
25779902 |
gggacgtcgtctttgaatcggcggtttagatcgtgaaatttttgttcgcagtggtgtgcggtggcgaggagggaagtgcggttggtacgtgactgaacct |
25780001 |
T |
 |
| Q |
201 |
ccatggcgatgatgtcc |
217 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
25780002 |
ccatggcgatggtgtcc |
25780018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University