View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6781_low_6 (Length: 461)
Name: NF6781_low_6
Description: NF6781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6781_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 5e-91; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 5e-91
Query Start/End: Original strand, 1 - 174
Target Start/End: Complemental strand, 44858857 - 44858684
Alignment:
| Q |
1 |
atgaatcaaatctcaaacagaaaatttactcaatttttataaacttaaacctgcattgagaagcatgctacgatcttggtggtaatgctctataatcggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44858857 |
atgaatcaaatctcaaacagaaaatttactcaatttttataaacttaaacctgcattgagaagcatgctacgatcttggtggtaatgctctataatcggt |
44858758 |
T |
|
| Q |
101 |
accaaatcctttgaaacgatgttccatttacacacttgcttgaacacatcgcgggattgcggatcatcacgtct |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44858757 |
accaaatcctttgaaacgatgttccatttacacactagcttgaacacatcgcgggattgcggatcatcacgtct |
44858684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 157; E-Value: 3e-83
Query Start/End: Original strand, 296 - 460
Target Start/End: Complemental strand, 44858562 - 44858398
Alignment:
| Q |
296 |
caaattcattcataccgagacagtattcacccttggaataaccgattcgtttgccttcatcatcttcttcaatggcgccgagaccgctgcagattaggga |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44858562 |
caaattcattcataccgagacagtattcacccttggaataaccgattcgtttgccttcatcatcttcttcaatggcgccgagaccgctgcagattaggga |
44858463 |
T |
|
| Q |
396 |
taatccatcggtgtccatggtgtttgggttttgagagaacgaagagatttggggatattcttgga |
460 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
44858462 |
taatccatcggtgtccatggtgtttgggttttgagagaacgaagagatttggggatttttttgga |
44858398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University