View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6782_low_18 (Length: 235)
Name: NF6782_low_18
Description: NF6782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6782_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 82 - 217
Target Start/End: Original strand, 35111688 - 35111823
Alignment:
| Q |
82 |
taataatagtgtgaattttggttatagcaatttctgcacaactttgaattaacaatcgactgtcttggttgttattggttaactgtttggctttttgaac |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35111688 |
taataatagtgtgaattttggttatagcaatttctgcacaactttgaattaacaatcgactgtcttggttgttattggttaactgtttggctttttgaac |
35111787 |
T |
 |
| Q |
182 |
ttaattgcaaacttttctctctatgaagtctctatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
35111788 |
ttaattgcaaacttttctctctatgaagtctctatg |
35111823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University