View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6782_low_19 (Length: 225)
Name: NF6782_low_19
Description: NF6782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6782_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 5 - 207
Target Start/End: Complemental strand, 37215863 - 37215661
Alignment:
| Q |
5 |
tgagatgaacagcaatagtgaagtgccatcgggcgatgagaccagccgcaccggagatcaatgggacaaggcagcgttgctagatcatggtaatcgacgc |
104 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37215863 |
tgagctgagcagcaatagtgaagtgccatcgggagatgagaccagccgcaccggagatcaatgggacaaggcagcgttgctcgatcatggtaatcgacgc |
37215764 |
T |
|
| Q |
105 |
gagggattggatgagacactacaaagctggattcttgaaaggccaaatatgaagaagaagaccaagtatgtggattttggatgcatcgtgttgagtcaca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37215763 |
gagggattggatgagacactacaaagctggattcttgaaaggccaaatatgaagaagaagaccaagtatgtggattttggatgcatcgtgttgagtcaca |
37215664 |
T |
|
| Q |
205 |
agg |
207 |
Q |
| |
|
||| |
|
|
| T |
37215663 |
agg |
37215661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University