View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6784_high_11 (Length: 234)
Name: NF6784_high_11
Description: NF6784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6784_high_11 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 11 - 234
Target Start/End: Complemental strand, 46840372 - 46840149
Alignment:
| Q |
11 |
catcatcaggtaacataatcagcttcaagtctggtaacttgacacggatgaagtcaaacgcttcccttaaaatgctcattaccaacacgagagtaggtag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46840372 |
catcatcaggtaacataatcagcttcaagtctggtaacttgacacggatgaagtcaaacgcttcccttaaaatgctcattaccaacacgagagtaggtag |
46840273 |
T |
|
| Q |
111 |
aaacacaaaagcattggtggctggtgtttctgagagaatgctgaggcacccagatgccattgcttttgtgtttactgctgtttattctatccgcaaaaaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| ||||| || |
|
|
| T |
46840272 |
aaacacaaaagcattggtggctggtgtttctgagagaatgctgaggcacccagatgccatggcttttgtgtttactgctgttgattctatcagcaaagaa |
46840173 |
T |
|
| Q |
211 |
ttgactaccgttctccagtcacct |
234 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
46840172 |
ttgactaccgttctccagtcacct |
46840149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University