View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6784_low_10 (Length: 268)
Name: NF6784_low_10
Description: NF6784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6784_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 69 - 249
Target Start/End: Complemental strand, 54987967 - 54987787
Alignment:
| Q |
69 |
ttggatggaaaaggataatgatcaaactccactgagaatgagaatgctccaagagcataggtagtgattaagaaaaagagtagtagtatctccatagata |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
54987967 |
ttggatggaaaaggataatgatcaaactcctctgagaatgagaatgctccaagagcataggtagtgattaagaaaaagagtagcagtatctccatagata |
54987868 |
T |
 |
| Q |
169 |
ctgctttctgaaaagtagataacttcaaactaattgatactctcaaatcaattaatgtcaaagaaaatttcatattcttaa |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
54987867 |
ctgctttctgaaaagtagataacttcaaactaattgatgctctcaactcaattaatgtcaaagaaaatttcatattcttaa |
54987787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University