View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6784_low_12 (Length: 240)
Name: NF6784_low_12
Description: NF6784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6784_low_12 |
 |  |
|
| [»] scaffold0212 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0212 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: scaffold0212
Description:
Target: scaffold0212; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 13 - 240
Target Start/End: Original strand, 11996 - 12223
Alignment:
| Q |
13 |
atcaaaaccgactgcctggatacagaccagattttgtccatgattattaaggtaaccagataagctccaggtttagttgtagttccgcggatagaggagc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11996 |
atcaaaaccgactgcctggatacagaccagattttgtccatgattattaaggtaaccagataagctccaggtttagttgtagttccgcggatagaggagc |
12095 |
T |
 |
| Q |
113 |
tgcttcgagcattggtatgaaacccggaatattttatttgaaatcgcgatgagttaaagaaacccacccggaattcagtccatgataggatagggaaaga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12096 |
tgcttcgagcattggtatgaaacccggaatattttatttgaaatcgcgatgagttaaagaaacccacccggaattcagtccatgataggatagggaaaga |
12195 |
T |
 |
| Q |
213 |
agcttgtgcatctttctattttatgttt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
12196 |
agcttgtgcatctttctattttatgttt |
12223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 56 - 235
Target Start/End: Original strand, 16576868 - 16577047
Alignment:
| Q |
56 |
ttattaaggtaaccagataagctccaggtttagttgtagttccgcggatagaggagctgcttcgagcattggtatgaaacccggaatattttatttgaaa |
155 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||| || ||||||||||| ||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
16576868 |
ttattaaggttatcagataagctccaggtttagttgtagtttcgtggatagaggagttgcttcgagtattggtatgaaacccgaaatattttatttgaaa |
16576967 |
T |
 |
| Q |
156 |
tcgcgatgagttaaagaaacccacccggaattcagtccatgataggatagggaaagaagcttgtgcatctttctatttta |
235 |
Q |
| |
|
||| ||||||||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16576968 |
tcgtgatgagttaaagaaatcaacccgaaattcagtccatgataggatagggaaagaagcttgtgcatctttctatttta |
16577047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 13 - 95
Target Start/End: Complemental strand, 9628897 - 9628815
Alignment:
| Q |
13 |
atcaaaaccgactgcctggatacagaccagattttgtccatgattattaaggtaaccagataagctccaggtttagttgtagt |
95 |
Q |
| |
|
||||||||||||||||| |||| ||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9628897 |
atcaaaaccgactgcctagatatagagcagattttgtccatgattattaaggtaactagataagctccaggtttagttgtagt |
9628815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University